The 14-3-3 protein is a family of highly conserved acidic proteins found in a wide range of eukaryotes from yeast to mammals. 14-3-3 acts as an adapter protein and interacts with signaling molecules including protein kinase C (PKC). Although 14-3-3 ζ was originally characterized as an endogenous PKC inhibitor, it was reported to activate PKC in vitro, but the in vivo regulation of PKC by 14-3-3 is still not well understood. To examine the regulation of PKC by 14-3-3 in the cell, we have generated a sub-cell line, PC12-B3, that stably expresses FLAG epitope-tagged 14-3-3 ζ isoform in PC12 cells. Here we show that PKC-α and PKC-ε become associated with 14-3-3 ζ when the cells are neuronally differentiated by nerve growth factor. We found that the immunoprecipitate by anti-FLAG antibody contains constitutive and autonomous Ca2+-independent non-classical PKC activity. In contrast, the FLAG immunoprecipitate has no Ca2+-dependent classical PKC activity despite the fact that PKC-α is present in the FLAG immunoprecipitate from differentiated PC12-B3 cells. Our results show that the association with 14-3-3 ζ has distinct effects on classical PKC and non-classical PKC activity. The 14-3-3 protein is a family of highly conserved acidic proteins found in a wide range of eukaryotes from yeast to mammals. 14-3-3 acts as an adapter protein and interacts with signaling molecules including protein kinase C (PKC). Although 14-3-3 ζ was originally characterized as an endogenous PKC inhibitor, it was reported to activate PKC in vitro, but the in vivo regulation of PKC by 14-3-3 is still not well understood. To examine the regulation of PKC by 14-3-3 in the cell, we have generated a sub-cell line, PC12-B3, that stably expresses FLAG epitope-tagged 14-3-3 ζ isoform in PC12 cells. Here we show that PKC-α and PKC-ε become associated with 14-3-3 ζ when the cells are neuronally differentiated by nerve growth factor. We found that the immunoprecipitate by anti-FLAG antibody contains constitutive and autonomous Ca2+-independent non-classical PKC activity. In contrast, the FLAG immunoprecipitate has no Ca2+-dependent classical PKC activity despite the fact that PKC-α is present in the FLAG immunoprecipitate from differentiated PC12-B3 cells. Our results show that the association with 14-3-3 ζ has distinct effects on classical PKC and non-classical PKC activity. protein kinase C non-classical PKC classical PKC nerve growth factor 12-O-tetradecanoylphorbol-13-acetate The 14-3-3 protein, a family of acidic 30-kDa proteins, is ubiquitous and highly enriched in the central nervous system (1Aitken A. Collinge D.B. van Heusden B.P. Isobe T. Roseboom P.H. Rosenfeld G. Soll J. Trends Biochem. Sci. 1992; 17: 498-501Abstract Full Text PDF PubMed Scopus (434) Google Scholar). It is estimated that ∼1% of the total cytosolic proteins expressed in the mammalian brain is 14-3-3 (2Aitken A. Amess B. Howell S. Jones D. Martin H. Patel Y. Robinson K. Toker A. Biochem. Soc. Trans. 1992; 20: 607-611Crossref PubMed Scopus (15) Google Scholar). 14-3-3 acts as an adapter protein and interacts with signaling molecules to mediate a wide variety of cellular events such as cell cycle regulation, cell growth and differentiation, anti-apoptosis, and synaptic transmission (For review, see Refs. 3Russell P. Trends Biochem. Sci. 1998; 23: 399-402Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 4Skoulakis E.M. Davis R.L. Mol. Neurobiol. 1998; 16: 269-284Crossref PubMed Scopus (134) Google Scholar, 5Fu H. Subramanian R.R. Masters S.C. Annu. Rev. Pharmacol. Toxicol. 2000; 40: 617-647Crossref PubMed Scopus (1328) Google Scholar). The 14-3-3 protein is conserved among species ranging from yeast to human and normally exists as a dimer. In the brain cytosol, seven 14-3-3 subspecies (α, β, γ, δ, ε, η, and ζ) were chromatographically separated, and of these, α and δ were found to be phosphorylated forms of β and ζ, respectively (6Aitken A. Howell S. Jones D. Madrazo J. Patel Y. J. Biol. Chem. 1995; 270: 5706-5709Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar). In addition, the θ isoform was also found in the rat brain (7Watanabe M. Isobe T. Ichimura T. Kuwano R. Takahashi Y. Kondo H. Inoue Y. Brain Res. Mol. Brain Res. 1994; 25: 113-121Crossref PubMed Scopus (69) Google Scholar) and was originally discovered in the T cell line as 14-3-3 τ (8Nielsen P.J. Biochim. Biophys. Acta. 1991; 1088: 425-428Crossref PubMed Scopus (51) Google Scholar). Thus, at least six 14-3-3 isoforms are present in the mammalian brain. leonardo, a Drosophila gene homologue of the vertebrate 14-3-3 ζ, is expressed in abundance in mushroom bodies, and mutants with low levels of expression of leonardo show deficiency in olfactory learning (9Skoulakis E.M. Davis R.L. Neuron. 1996; 17: 931-944Abstract Full Text Full Text PDF PubMed Scopus (183) Google Scholar). The Leonardo protein is also highly enriched in the presynaptic boutons in the fly neuromuscular junction (10Broadie K. Rushton E. Skoulakis E.M. Davis R.L. Neuron. 1997; 19: 391-402Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Significant reduction of glutamate synaptic transmission has been observed at the neuromuscular junctions ofleonardo (−/−) null mutant larvae, and this effect is attributed to a presynaptic mechanism (10Broadie K. Rushton E. Skoulakis E.M. Davis R.L. Neuron. 1997; 19: 391-402Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Consistent with this notion, the Leonardo protein was recently shown inDrosophila neuromuscular junction to form a complex with the Ca 2+ -dependent K+channel, Slowpoke, at the presynaptic nerve terminals (11Zhou Y. Schopperle W.M. Murrey H. Jaramillo A. Dagan D. Griffith L.C. Levitan I.B. Neuron. 1999; 22: 809-818Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar). Although very little is known regarding the function of vertebrate 14-3-3 ζ in neuronal cells, several lines of evidence indicate that it plays a role in synaptic function in vertebrates as well. Immunological and biochemical studies show that mammalian 14-3-3 ζ localizes in synapses in the rat brain (12Martin H. Rostas J. Patel Y. Aitken A. J. Neurochem. 1994; 63: 2259-2265Crossref PubMed Scopus (147) Google Scholar). The 14-3-3 protein was involved in exocytosis; it stimulates Ca 2+ -dependent catecholamine release from digitonin-permeabilized adrenal chromaffin cells (13Morgan A. Burgoyne R.D. Nature. 1992; 355: 833-836Crossref PubMed Scopus (159) Google Scholar, 14Morgan A. Burgoyne R.D. Biochem. J. 1992; 286: 807-811Crossref PubMed Scopus (64) Google Scholar, 15Burgoyne R.D. Morgan A. Robinson I. Pender N. Cheek T.R. J. Anat. 1993; 183: 309-314PubMed Google Scholar), in which 14-3-3 ζ is one of the major isoforms (16Roth D. Morgan A. Martin H. Jones D. Martens G.J. Aitken A. Burgoyne R.D. Biochem. J. 1994; 301: 305-310Crossref PubMed Scopus (59) Google Scholar). One of the target molecules of 14-3-3 is protein kinase C (PKC).1 14-3-3, originally discovered as an activator protein for tyrosine hydroxylase and tryptophan hydroxylase (17Yamauchi T. Nakata H. Fujisawa H. J. Biol. Chem. 1981; 256: 5404-5409Abstract Full Text PDF PubMed Google Scholar), was isolated as an endogenouskinase Cinhibitoryprotein (KCIP) (18Toker A. Ellis C.A. Sellers L.A. Aitken A. Eur. J. Biochem. 1990; 191: 421-429Crossref PubMed Scopus (186) Google Scholar). It was later found that KCIP was identical to the 14-3-3 protein (19Toker A. Sellers L.A. Amess B. Patel Y. Harris A. Aitken A. Eur. J. Biochem. 1992; 206: 453-461Crossref PubMed Scopus (123) Google Scholar). However, it has been reported that 14-3-3 ζ activates rather than inhibits PKC in vitro(20Isobe T. Hiyane Y. Ichimura T. Okuyama T. Takahashi N. Nakajo S. Nakaya K. FEBS Lett. 1992; 308: 121-124Crossref PubMed Scopus (79) Google Scholar, 21Tanji M. Horwitz R. Rosenfeld G. Waymire J.C. J. Neurochem. 1994; 63: 1908-1916Crossref PubMed Scopus (52) Google Scholar). Thus, although 14-3-3 was initially characterized as a PKC inhibitor, its effect on PKC is still not clear. Because PKC is critical for neuronal differentiation in PC12 cells (22Hundle B. McMahon T. Dadgar J. Messing R.O. J. Biol. Chem. 1995; 270: 30134-30140Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar, 23Hundle B. McMahon T. Dadgar J. Chen C.H. Mochly-Rosen D. Messing R.O. J. Biol. Chem. 1997; 272: 15028-15035Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar, 24O'Driscoll K.R. Teng K.K. Fabbro D. Greene L.A. Weinstein I.B. Mol. Biol. Cell. 1995; 6: 449-458Crossref PubMed Scopus (60) Google Scholar, 25Coleman E.S. Wooten M.W. J. Mol. Neurosci. 1994; 5: 39-57Crossref PubMed Scopus (55) Google Scholar, 26Brodie C. Bogi K. Acs P. Lazarovici P. Petrovics G. Anderson W.B. Blumberg P.M. Cell Growth Differ. 1999; 10: 183-191PubMed Google Scholar), we have investigated whether the interaction between PKC and 14-3-3 ζ takes place and how it affects the PKC activity in neuronal cells. For this purpose, we have established a sub-cell line of PC12 cells (PC12-B3 cells) that stably express FLAG epitope-tagged 14-3-3 ζ. Here we show the selective association of 14-3-3 ζ with PKC-α and PKC-ε in NGF- differentiated PC12-B3 cells. Furthermore, we found that the 14-3-3 ζ immunoprecipitate by anti-FLAG antibody from the NGF-differentiated cells contains Ca2+-independent non-classical PKC (nPKC) activity. This nPKC is constitutively active and does not require any addition of PKC activators. Such constitutive activation of nPKC in the 14-3-3 ζ complex might play an important role in neuronal differentiation of PC12 cells by NGF. 14-3-3 ζ cDNA isolated from rat hippocampal cDNA library (pB5BN7, Ref. 27Murakami K. Situ S.Y. Eshete F. Gene. 1996; 179: 245-249Crossref PubMed Scopus (5) Google Scholar) and subcloned in mammalian expression vector pcDNA3 (clone pc14ζ12) was used for the study. FLAG epitope (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) was tagged at the C terminus of 14-3-3 ζ and subcloned at NotI andHindIII sites of pcDNA3 as follows. FLAG-tagged 14-3-3 ζ cDNA was amplified by PCR using pc14ζ12 as a template with a FLAG-tagging primer containing NotI overhang (ATAGTTTAGCGGCCGCTTACTTGTCATCG TCGTCCTTGTAGTCATTTTCCCCTCCTTCTCC) and T7 primer (AATACGACTCACTATAGGG) with Pfu DNA polymerase (CLONTECH). The amplified cDNA was digested byHindIII and NotI and subcloned in pcDNA3 at these sites (clone pC14ζ-FLAG). Fidelity of the amplified cDNA was confirmed by DNA sequencing. Rat 14-3-3 ζ has three protein variant forms (Met88-Ala109, Thr88-Ala109, and Thr88-Arg109) (27Murakami K. Situ S.Y. Eshete F. Gene. 1996; 179: 245-249Crossref PubMed Scopus (5) Google Scholar). To determine which 14-3-3 ζ variant is expressed in PC12 cells, we performed reverse transcription-PCR. Total RNA from PC12 cells was isolated using RNA isolation kit (Ambion) and reverse-transcribed for cDNA synthesis by avian myeloblastosis virus reverse transcriptase using oligo-dT primer. Endogenous 14-3-3 ζ cDNA was amplified by PCR and sequenced. PC12 cells were cultured in collagen–coated dishes containing 15 ml of RPMI 1640 medium supplemented with 10% heat-inactivated horse serum and 5% fetal bovine serum in a humidified incubator (95% air, 5% CO2) at 37 °C (28Greene L.A. Sobeih M.M. Teng K.K. Banker G. Goslin K. Culturing Nerve Cells. MIT Press, Cambridge, MA1991: 207-226Google Scholar). The medium was changed every 2 days and split once a week. Parental PC12 cells and its sub-cell line PC12-B3, which expresses FLAG epitope-tagged 14-3-3 ζ, were differentiated by 50 ng/ml NGF. For transfection, 1.4 × 105 cells were plated in a 60-mm collagen-coated dish and grown in the serum containing RPMI 1640 media overnight. Before transfection, cells were washed three times with 5 ml of phosphate-buffered saline and incubated in 5 ml of OptiMEM (Invitrogen) for 45 min. After the incubation, 2.5 ml of the medium was removed and replaced with the same amount of OptiMEM containing 30 μg of pC14ζ-FLAG and 60 μl of Lipofectin (Invitrogen) and incubated at 37 °C for 45 min. OptiMEM was then added for a final volume of 10 ml and further incubated for 30 h. After this transfection, the medium was replaced with RPMI 1640 with 10% horse serum and 5% fetal bovine serum, and the cells were maintained for 1 week. PC12 sub-cell lines that stably express FLAG epitope-tagged 14-3-3 ζ were selected based on the neomycin resistance. The transfected cells were grown in the presence of 500 μg/ml G418 for 6 days, and the surviving single cells were removed and expanded in a collagen-coated 12-well plate in serum-containing preconditioned RPMI 1640 media. Immunoblot analysis was carried out by a standard procedure (29Harlow E. Lane D. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1988: 471-510Google Scholar). Anti-FLAG (Eastman Kodak Co, Sigma), anti-14-3-3 ζ (Santa Cruz), and isoform-specific anti PKC antibodies (Transduction Laboratories, Santa Cruz) were used for the study. Horseradish peroxidase-conjugated anti-mouse (Amresco, Santa Cruz) or anti-rabbit IgG (Amersham Biosciences) were employed as the secondary antibody, and the blot was visualized using the ECL method (Amersham Biosciences). In some experiments that required quantification, we directly measured chemiluminescence using FluorS Multi-imager (Bio-Rad) and analyzed by Quantity 1 program. The following immunoprecipitation procedures were carried out at 4 °C. Cells grown on 100-mm collagen-coated dishes were washed with phosphate-buffered saline twice before lysis. RIPA buffer containing protease inhibitors (20 μg/ml leupeptin, 10 μg/ml pepstatin A, 10 μg/ml chymostatin, 2 μg/ml aprotinin, 1 mm phenylmethylsulfonyl fluoride) were added for cell lysis and incubated for 30 min. The cell lysate was collected, triturated, and centrifuged at 1000 × g for 10 min. To preclear the cell lysate, the supernatant was mixed with 20 μl of protein A beads (Invitrogen), incubated for 30 min while rocking, and centrifuged for 15 min at 1000 × g. Precleared samples were incubated with a primary antibody for 2 h with rocking, and then protein A beads were added, incubated for 1 h, and centrifuged at 1000 × g. The immunoprecipitates were collected and washed three times with RIPA buffer. The activity of PKC of the immunoprecipitates with FLAG antibody from differentiated or undifferentiated cells was measured using two PKC assay systems that were optimized for Ca2+-dependent cPKC activity and for Ca2+-independent non-classical novel and atypical PKC activities (hereafter cPKC and nPKC assay, respectively). The FLAG immunoprecipitates for PKC assay were prepared from cell culture grown in 100-mm collagen-coated dish. The immunoprecipitated samples were washed 3 times with ice-cold dilution buffer (20 mmTris-HCl, 1 mm EGTA, 1 mm dithiothreitol, pH 7.4), centrifuged at 12,000 × g, and then diluted to 250 μl with ice-cold dilution buffer. Ten μl of the aliquot was assayed to measure PKC activity in the presence of 5 mmMgCl2, 1 mm EGTA, 20 mm Tris-HCl, pH 7.4, with the appropriate concentrations of Ca 2+ , PKC substrate, and PKC activators or inhibitors as specified below or in the figure legends. For Ca2+-dependent cPKC assay, 400 μg/ml lysine-rich histone (Type IIIS: Sigma) was used for the assay at 500 μm free Ca 2+ . nPKC assay was performed in the absence of Ca 2+ using 100 μg/ml peptide-ε (Bacham) as a PKC substrate in the presence of 1 mm EGTA. The selection of PKC substrates was based on the difference in specificity between cPKCs and nPKCs; lysine-rich histone is a good substrate of PKC-α, -β, and -γ and can be readily phosphorylated by these cPKCs, but it is a poor substrate for Ca 2+ -independent PKCs (30Olivier A.R. Kiley S.C. Pears C. Schaap D. Jaken S. Parker P.J. Biochem. Soc. Trans. 1992; 20: 603-607Crossref PubMed Scopus (9) Google Scholar). In contrast, nPKC activity is poor toward histone, but it effectively phosphorylates peptide-ε (30Olivier A.R. Kiley S.C. Pears C. Schaap D. Jaken S. Parker P.J. Biochem. Soc. Trans. 1992; 20: 603-607Crossref PubMed Scopus (9) Google Scholar). For calcium dependence experiments, total Ca 2+ concentrations to achieve appropriate free Ca 2+ concentrations were controlled by taking account of multiple equilibria with EGTA, ATP, and Mg2+(31Brooks S.P.J. Storey K.B. Anal. Biochem. 1992; 201: 119-126Crossref PubMed Scopus (324) Google Scholar). A phosphorylation reaction was initiated by adding [γ-32P]ATP (final concentration, 75 μm; 150–200 cpm/pmol) to a reaction tube in a total volume of 50 μl. After a 20 min incubation at 30 °C, protein A-Sepharose beads in the reaction mixture was centrifuged by pulse spin, 30 μl of the supernatant was spotted onto phosphocellulose paper, and the radioactivity was counted after the wash. Our previous study showed that there are several variants of 14-3-3 ζ cloned from mammalian brain. These variations are composed of the amino acids Met ↔ Thr at position 88, Ala ↔ Arg at 109, and Pro ↔ Ala at 112. In the rat brain, Met ↔ Thr and Ala ↔ Arg 14-3-3 ζ variants are present (27Murakami K. Situ S.Y. Eshete F. Gene. 1996; 179: 245-249Crossref PubMed Scopus (5) Google Scholar). Because the 14-3-3 protein binds to a variety of signaling molecules and acts as an adapter/scaffold protein, these variations may have effects on partner proteins for the interaction. To avoid the ambiguity due to the 14-3-3 ζ protein variants, we have identified the endogenous 14-3-3 ζ in PC12 cells by reverse transcription-PCR. This analysis showed that endogenous 14-3-3 ζ contains Met, Ala, and Pro at the respective positions. We have added a FLAG epitope tag to this variant 14-3-3 ζ and expressed the variant in PC12 cells. To establish PC12 sub-cell lines that stably express the FLAG-14-3-3 ζ, transfected cells were initially selected with G418, and the surviving cells were individually picked and expanded. To determine whether these clones express the epitope-tagged 14-3-3 ζ, they were screened by Western blot using antibodies against FLAG epitope and 14-3-3 ζ. 14-3-3 ζ antibody recognized 30- and 31-kDa doublet bands, whereas the anti-FLAG antibody only recognized the 31-kDa band in positive clones that express FLAG epitope-tagged 14-3-3 ζ (data not shown). This indicates that the 30-kDa protein is the endogenous 14-3-3 ζ, whereas 31-kDa protein is the recombinant 14-3-3 ζ with the size increase due to the addition of a FLAG tag. There was no apparent difference in B3, one of the expanded clonal sub-cell line, in morphology and the sensitivity to NGF from the parent PC12 cells. We therefore used PC12-B3 as a PC12 sub cell-line that stably expresses epitope-tagged 14-3-3 ζ. To investigate the interaction between 14-3-3 ζ and PKC, we first determined the PKC isoforms that are expressed in PC12-B3 cells and its parent PC12 cell line. Significant immunoreactivity against PKC-α, -δ, -ε, -ζ, -λ(ι), and -μ were found, but we could not detect immunoreactivity against PKC-β, -γ, and -θ in PC12-B3 or in the parent PC12 cell line (see TableI). Because PKC has been shown to play a role in neuronal as well as NGF-induced PC12 cell differentiation, we have attempted to determine whether the 14-3-3 ζ association with PKC is different in differentiated cells when compared with undifferentiated cells. We first examined PKC-ε since it is among the PKC isoforms critical for PC12 cell differentiation (22Hundle B. McMahon T. Dadgar J. Messing R.O. J. Biol. Chem. 1995; 270: 30134-30140Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar, 23Hundle B. McMahon T. Dadgar J. Chen C.H. Mochly-Rosen D. Messing R.O. J. Biol. Chem. 1997; 272: 15028-15035Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar,26Brodie C. Bogi K. Acs P. Lazarovici P. Petrovics G. Anderson W.B. Blumberg P.M. Cell Growth Differ. 1999; 10: 183-191PubMed Google Scholar, 32Ohmichi M. Zhu G. Saltiel A.R. Biochem. J. 1993; 295: 767-772Crossref PubMed Scopus (48) Google Scholar). As shown in Fig 1, PKC-ε co-immunoprecipitates with FLAG-14-3-3 ζ in differentiated PC12-B3 cells but not in undifferentiated cells. The anti-PKC-ε antibody immunoprecipitated sample contains FLAG-14-3-3 ζ (Fig.1 A), whereas the anti-FLAG antibody immunoprecipitate contains PKC-ε (Fig. 1 B) in the differentiated cells. In contrast, co-immunoprecipitation of PKC-ε and FLAG-14-3-3 ζ cannot be detected from undifferentiated cells, even though both are present in these cells, and the levels of expression of 14-3-3 ζ and PKC-ε remain constant during differentiation.Table IPresence of PKC subtypes in PC12-B3 cells and their association with 14-3-3 ζ in undifferentiated and differentiated stagesPKC subtypesPresence in PC12-B3 cellsCo-immunoprecipitation with 14-3-3 ζUndifferentiatedDifferentiatedα+−+β−−−γ−−−δ+++ε+−+ζ+++λ (ι)+−−μ+++θ−−− Open table in a new tab To examine whether PKC-ε associates not only with the recombinant 14-3-3 ζ but also with the endogenous 14-3-3 ζ in a manner dependent on neuronal differentiation, we prepared immunoprecipitation samples using anti-14-3-3 ζ antibody from undifferentiated and NGF-differentiated PC12 cells. As shown in Fig.2, endogenous 14-3-3 ζ co-immunoprecipitates with PKC-ε only from NGF-differentiated cells, but the co-immunoprecipitation is not detected from undifferentiated PC12 cells. Thus, PKC-ε interacts with both the recombinant FLAG-14-3-3 ζ as well as with the endogenous 14-3-3 ζ in neuronally differentiated PC12 cells but not in undifferentiated cells. One of the key questions regarding the association of PKC-ε with 14-3-3 ζ is whether this complex formation is acutely induced by the receptor activation by NGF or if it is a reflection of the differentiated state of PC12 cells. To determine this, we measured the time course of the complex formation of PKC-ε and 14-3-3 ζ by examining FLAG immunoprecipitates from PC12 B-3 cells treated with NGF with a time course of 5 min to 8 days. Co-immunoprecipitation of PKC-ε and FLAG 14-3-3 ζ can be seen only after 5 days of NGF treatment, as shown in Fig. 3. This slow onset of the association indicates that the complex formation is not due to the acute effect of stimulation of NGF receptors, but it is associated at the final differentiation stage of PC12 cells. We have tested whether the PKC-ε/14-3-3 ζ interaction is specific to this PKC isoform. Among the immunoreactivity found in this sub-cell line, we have found that PKC-α, δ, -ζ, and -μ isoforms also associate with FLAG-14-3-3, as shown in Fig. 4. However, the interaction of these PKC isoforms with 14-3-3 ζ is different with respect to differentiation. PKC-ζ and -μ isoforms were immunoprecipitated with FLAG antibody regardless of differentiation, suggesting that they interact with 14-3-3 ζ constitutively. PKC-δ is also present in the FLAG immunoprecipitates from both undifferentiated and differentiated cells. However, the association of PKC-δ with FLAG-14-3-3 ζ shows a consistent increase during differentiation (n = 3), suggesting that the interaction of this PKC isoform with 14-3-3 ζ could also be sensitive to NGF-induced neuronal differentiation. Contrary to the PKC-ζ, -μ, and -δ isoforms, co-immunoprecipitation of PKC-α with 14-3-3 ζ can be detected only when the cells were neuronally differentiated. We could not detect PKC-α immunoreactivity, however, in the FLAG immunoprecipitate prepared from undifferentiated cells, indicating that either this isoform is not present in the immunoprecipitate or the level is too low for detection. Thus, the interaction between PKC-α and 14-3-3 ζ in PC12-B3 cells depends on the state of differentiation. These experiments show that PKC isoforms bind to 14-3-3 ζ in a differentiation-dependent as well as -independent manner. The results are summarized in Table I. The FLAG immunoprecipitate contains several PKC isoforms, Ca 2+ -dependent PKC-α and Ca 2+ -independent PKC-δ, -ε, -ζ, and -μ in NGF-differentiated PC12-B3 cells. To distinguish Ca 2+ -dependent and Ca 2+ -independent PKC activities, we developed assays that detect these PKC activities in the FLAG immunoprecipitates as described under “Experimental Procedures.” Using these assays, we measured the PKC activity in the FLAG immunoprecipitates from differentiated and undifferentiated PC12 B-3 cells. Parent PC12 cells that do not express FLAG epitope-tagged 14-3-3 ζ was used as a negative control. As shown in Fig. 5, significant Ca 2+ -independent PKC activity was detected in the immunoprecipitate from NGF-differentiated cells, even in the absence of PKC activators. This activity can be further stimulated by TPA but inhibited to the basal level by a serine/threonine kinase inhibitor H7 or by GF109203X, a PKC-specific inhibitor (see Fig. 8). In contrast, the immunoprecipitate from undifferentiated cells has no detectable Ca 2+ -independent PKC activity. These results show that 14-3-3 ζ-PKC complex in differentiated cells has constitutive and autonomous Ca 2+ -independent nPKC activity, whereas the complex in undifferentiated cells does not have detectable activity of nPKC.Figure 8Sensitivity to Ca2+ and arachidonic acid of the nPKC activity in FLAG immunoprecipitate from NGF-differentiated PC12-B3 cells. Sensitivity to arachidonic acid and Ca2+ of the constitutive and autonomous nPKC activity found in the FLAG immunoprecipitate from differentiated cells. The nPKC activity was further stimulated by 10 μm arachidonic acid and inhibited by 10 μm GF109203X. Measurement of nPKC activity and control of free Ca2+ concentrations are described under “Experimental Procedures.”View Large Image Figure ViewerDownload Hi-res image Download (PPT) PKC-α, a Ca 2+ -dependent cPKC, becomes associated with 14-3-3 ζ during neuronal differentiation induced by NGF. However, there was no detectable Ca2+-dependent PKC activity in the immunoprecipitate regardless of differentiation as shown in Fig.6. Furthermore, TPA has no effect on the PKC activity. The lack of activity in the tested samples is not due to a failure of the detection of cPKC activity, since purified PKC-α can be activated in this cPKC assay system as shown in theinset. Because PKC-β or -γ isoforms are not present in the FLAG immunoprecipitate, these results suggest that PKC-α associated with 14-3-3 ζ in differentiated cells is inactive and insensitive to PKC activators. However, it is possible that the lack of cPKC activity could be simply due to an amount of PKC-α present in the immunoprecipitate that was too small for detection. To examine this, we have done parallel experiments in which we measure the amount of PKC-α in the immunoprecipitate by comparing with known quantities of purified PKC-α to determine the amount of the enzyme and cPKC kinase activity in the immunoprecipitate. As shown in Fig.7, the immunoprecipitate used for cPKC assay (lanes 1 and 2 shown in duplicate) emitted chemiluminescence of 289 ± 142 (arbitrary unit), whereas there was no chemiluminescence observed for purified PKC-α up to 5 ng. The detection of purified PKC-α requires at least 5–10 ng of the enzyme (Fig. 7 B). Based on these analyses, the amount of PKC-α in the immunoprecipitated sample used for cPKC assay was estimated to be ∼6 ng/reaction tube. The activity of purified PKC-α could be clearly detected as low as 0.2 ng in the cPKC activity used for the study (data not shown). On the contrary, the 14-3-3 ζ immunoprecipitate visualized in Fig. 7 A is only at the background level (Table II). Based on these analyses, we conclude that the PKC-α is inactive in the immunoprecipitate from differentiated PC12 cells.Figure 7Quantification of PKC -α in the 14-3-3 ζ immunoprecipitate by chemiluminescence. A, to quantify the amount of PKC-α in the immunoprecipitate (IP) sample from differentiated PC12 cells, immunoprecipitate samples and different amounts of purified PKC-α used for cPKC assay were analyzed by Western blot followed by chemiluminescent measurements. Lanes 1 and 2, IP samples diluted 1:10 for cPKC assay shown in Table II. Lanes 3 and 4, undiluted immunoprecipitate samples from differentiated PC12 cells prepared in separate experiments. Lanes 5–8, different quantities (5–0.04 ng) of purified PKC-α. Lane 9, hippocampal lysate used for a positive control. B, chemiluminescence at higher quantities (50–0.4 ng) of purified PKC-α measured under the same conditions as in A. Ab, antibody.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table IIcPKC activity of immunoprecipitate sample from differentiated PC12 cellsActivators/Inhibitorscpm1 μmTPA + 100 μm DOPS291 ± 181 μm TPA + 100 μm DOPS/5 μm GF109203X237 ± 33No activator321 ± 64Background251 ± 46 Open table in a new tab In addition to diacylglycerol, PKC can be activated by cis-unsaturated fatty acids such as arachidonic acid (33McPhail L.C. Clayton C.C. Snyderman R. Science. 1984; 224: 622-625Crossref PubMed Scopus (494) Google Scholar, 34Murakami K. Chan S.Y. Routtenberg A. J. Biol. Chem. 1986; 261: 15424-15429Abstract Full Text PDF PubMed Google Scholar, 35Chen S.G. Murakami K. Biochem. J. 1992; 282: 33-39Crossref PubMed Scopus (60) Google Scholar). Arachidonic acid is a potent activator of PKC-ε in vitro (36Koide H. Ogita K. Kikkawa U. Nishizuka Y. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1149-1153Crossref PubMed Scopus (182) Google Scholar) and stimulates the redistribution/translocation of PKC-ε in intact cells (37Huang X.P., Pi, Y. Lokuta A.J. Greaser M.L. Walker J.W.